DNA sequence that increases odorant receptor representation in the olfactory system
US10512253B2 · kind B2 · utility
0Cited by
0References
9Claims
0Family size
Assignee
Inventors
Key dates
| Filing date | Aug 3, 2016 |
| Grant date | Dec 24, 2019 |
| Priority date | — |
| Expiry date | Sep 13, 2036 |
Classification
- Technology area (CPC A)Human Necessities
- CPC primaryA01K2267/02
- WIPO fieldBiotechnology
- WIPO sectorChemistry
Abstract
A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.
Source: USPTO / EPO open patent data. Objective bibliographic and citation counts.