Reagent and method for rapid detection of porcine adenovirus
US11098380B2 · kind B2 · utility
0Cited by
0References
4Claims
0Family size
Assignee
Inventors
Key dates
| Filing date | Oct 29, 2018 |
| Grant date | Aug 24, 2021 |
| Priority date | — |
| Expiry date | Jun 22, 2039 |
Classification
- Technology area (CPC C)Chemistry; Metallurgy
- CPC primaryC12Q2600/16
- WIPO fieldBiotechnology
- WIPO sectorChemistry
Abstract
The invention provides are agent and a method using this reagent for the detection of porcine adenovirus in a sample. The reagent comprises the following primer pair: the upstream primer: (5′-3′) ATCTTGAAATCACAATTCTTCTG (SEQ ID NO: 1); the downstream primer: (5′-3′) CAAGGAGCAGYTGGTGGAG (SEQ ID NO: 2), among the downstream primer Y can be T or C. This reagent and method are of strong specificity and high sensitivity, which can rapidly detect pig porcine adenovirus in samples.
Source: USPTO / EPO open patent data. Objective bibliographic and citation counts.