Patent · US Active

DNA sequence that increases odorant receptor representation in the olfactory system

US12063914B2 · kind B2 · utility

0Cited by
0References
6Claims
0Family size

Assignee

Inventors

Key dates

Filing dateDec 5, 2019
Grant dateAug 20, 2024
Priority date
Expiry dateJan 11, 2042

Classification

  • Technology area (CPC A)Human Necessities
  • CPC primaryA01K2267/02
  • WIPO fieldBiotechnology
  • WIPO sectorChemistry

Abstract

A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.

Source: USPTO / EPO open patent data. Objective bibliographic and citation counts.