Detection for Staphylococcus spp.
US5437978A · kind A · utility
33Cited by
1References
20Claims
0Family size
Assignee
Inventors
Key dates
| Filing date | Aug 4, 1992 |
| Grant date | Aug 1, 1995 |
| Priority date | — |
| Expiry date | Aug 4, 2012 |
Classification
- Technology area (CPC C)Chemistry; Metallurgy
- CPC primaryC12Q2600/156
- WIPO fieldBiotechnology
- WIPO sectorChemistry
Abstract
The present invention discloses a primer for detecting methicillin-resistant or toxic shock syndrome toxin-1 Staphylococcus spp. comprising any one of nucleotide fragments of sequences (1) to (4): EQU 5'GAAATGACTGAACGTCCGAT (1) EQU 5'GCGATCAATGTTACCGTAGT (2) EQU 5'AGTATGGGCCAAAGTTCGAT (3) EQU 5'CACTTTGATATGTGGATCCG (4) a method and kit for detecting these bacteria using the primer. The present invention makes direct and rapid detection of MRS and/or TPS from samples possible, and enables patients with infections caused by these bacteria to be treated at an early stage.
Source: USPTO / EPO open patent data. Objective bibliographic and citation counts.