Patent · US Expired

Method and kit for detecting methicillin-resistant Staphylococcus aureus

US5702895A · kind A · utility

122Cited by
0References
11Claims
0Family size

Assignee

Inventors

Key dates

Filing dateJan 16, 1996
Grant dateDec 30, 1997
Priority date
Expiry dateJan 16, 2016

Classification

  • Technology area (CPC Y)Emerging Cross-Sectional Technologies
  • CPC primaryY10S435/883
  • WIPO fieldBiotechnology
  • WIPO sectorChemistry

Abstract

A method and a kit for detecting methicillin-resistant Staphylococcus aureus which use, as primers in a gene amplification reaction, the four oligonucleotides represented by the following nucleotide sequences (1) through (4): EQU 5'AGAAATGACTGAACGTCCG3' (SEQ ID NO:1) (1) EQU 5'GCGATCAATGTTACCGTAG3' (SEQ ID NO:2) (2) EQU 5'TACATGTCGTTAAACCTGGTG3' (SEQ ID NO:3) (3) EQU 5'TACAGTTGTACCGATGAATGG3' (SEQ ID NO:4) (4) wherein A, G, C, and T denote adenine, guanine, cytosine, and thymine, respectively, and any T may be substituted by uracil (U). According to the method and kit of the present invention, it is possible to detect MRSA accurately and rapidly while distinguishing it from MR-CNS. Thus, proper treatment and prevention can be achieved against MRSA infections.

Source: USPTO / EPO open patent data. Objective bibliographic and citation counts.