Method and kit for detecting methicillin-resistant Staphylococcus aureus
US5702895A · kind A · utility
Assignee
Inventors
Key dates
| Filing date | Jan 16, 1996 |
| Grant date | Dec 30, 1997 |
| Priority date | — |
| Expiry date | Jan 16, 2016 |
Classification
- Technology area (CPC Y)Emerging Cross-Sectional Technologies
- CPC primaryY10S435/883
- WIPO fieldBiotechnology
- WIPO sectorChemistry
Abstract
A method and a kit for detecting methicillin-resistant Staphylococcus aureus which use, as primers in a gene amplification reaction, the four oligonucleotides represented by the following nucleotide sequences (1) through (4): EQU 5'AGAAATGACTGAACGTCCG3' (SEQ ID NO:1) (1) EQU 5'GCGATCAATGTTACCGTAG3' (SEQ ID NO:2) (2) EQU 5'TACATGTCGTTAAACCTGGTG3' (SEQ ID NO:3) (3) EQU 5'TACAGTTGTACCGATGAATGG3' (SEQ ID NO:4) (4) wherein A, G, C, and T denote adenine, guanine, cytosine, and thymine, respectively, and any T may be substituted by uracil (U). According to the method and kit of the present invention, it is possible to detect MRSA accurately and rapidly while distinguishing it from MR-CNS. Thus, proper treatment and prevention can be achieved against MRSA infections.
Source: USPTO / EPO open patent data. Objective bibliographic and citation counts.