Detection of human herpes virus 6 (HHV6)
US6627418B1 · kind B1 · utility
0Cited by
1References
3Claims
0Family size
Assignee
Inventors
Key dates
| Filing date | May 15, 2001 |
| Grant date | Sep 30, 2003 |
| Priority date | — |
| Expiry date | May 15, 2021 |
Classification
- Technology area (CPC C)Chemistry; Metallurgy
- CPC primaryC12Q1/705
- WIPO fieldBiotechnology
- WIPO sectorChemistry
Abstract
The present invention relates to methods for detecting viral pathogens, particularly human herpes virus S (HHV6), preferably using polymerase chain reaction (PCR) techniques. Primer sequences useful in these methods are also described. In a first aspect, the invention provides an isolated nucleic add molecule complementary to and specific for human herpes virus 6 (HHV6) DNA including a sequence selected from 5′CTTCTGTTTTAAGTCGTACAGGAGT (SEQ ID NO: 1), 5′ACAATTGCCATTTCGGGGAAGTAC (SEQ ID NO: 2), and functionally equivalent sequences. A method for detecting HHV6 in a sample suspected of containing HHV6 is also provided.
Source: USPTO / EPO open patent data. Objective bibliographic and citation counts.