Specific ligand for annexin 2
US8940886B2 · kind B2 · utility
Assignee
Inventors
Key dates
| Filing date | Nov 10, 2011 |
| Grant date | Jan 27, 2015 |
| Priority date | — |
| Expiry date | Jan 22, 2032 |
Classification
- Technology area (CPC C)Chemistry; Metallurgy
- CPC primaryC12N2310/3517
- WIPO fieldOrganic fine chemistry
- WIPO sectorChemistry
Abstract
The present invention relates to an aptamer which includes a nucleic acid including or made up of: the sequence GGAACGCAAGAACUGAGGCCAUGAGGCGCCUUCCCUUGCUCA GGACGC (SEQ ID NO: 1), or the sequence AGCUAGGCCGCAAGGUGCCUCAACGCCAUCUGAGUGCCGACC CGAUCGC (SEQ ID NO: 2), or a sequence including or made up of at least 25 consecutive nucleotides of a sequence that is at least 80% identical to SEQ ID NO: 1 or to SEQ ID NO: 2, with the condition that a nucleic acid made up of said sequence is bonded to annexin 2.
Source: USPTO / EPO open patent data. Objective bibliographic and citation counts.