Patent · US Active

Specific ligand for annexin 2

US8940886B2 · kind B2 · utility

0Cited by
0References
11Claims
0Family size

Assignee

Inventors

Key dates

Filing dateNov 10, 2011
Grant dateJan 27, 2015
Priority date
Expiry dateJan 22, 2032

Classification

  • Technology area (CPC C)Chemistry; Metallurgy
  • CPC primaryC12N2310/3517
  • WIPO fieldOrganic fine chemistry
  • WIPO sectorChemistry

Abstract

The present invention relates to an aptamer which includes a nucleic acid including or made up of: the sequence GGAACGCAAGAACUGAGGCCAUGAGGCGCCUUCCCUUGCUCA GGACGC (SEQ ID NO: 1), or the sequence AGCUAGGCCGCAAGGUGCCUCAACGCCAUCUGAGUGCCGACC CGAUCGC (SEQ ID NO: 2), or a sequence including or made up of at least 25 consecutive nucleotides of a sequence that is at least 80% identical to SEQ ID NO: 1 or to SEQ ID NO: 2, with the condition that a nucleic acid made up of said sequence is bonded to annexin 2.

Source: USPTO / EPO open patent data. Objective bibliographic and citation counts.