TRPM-2 antisense therapy using an oligonucleotide having 2′-O-(2-methoxy)ethyl modifications
US6900187B2 · kind B2 · utility
22Cited by
4References
11Claims
0Family size
Assignee
Inventors
Key dates
| Filing date | Feb 22, 2002 |
| Grant date | May 31, 2005 |
| Priority date | — |
| Expiry date | Oct 15, 2023 |
Classification
- Technology area (CPC C)Chemistry; Metallurgy
- CPC primaryC12N2310/346
- WIPO fieldPharmaceuticals
- WIPO sectorChemistry
Abstract
A compound consisting of an oligonucleotide of sequence CAGCAGCAGAGTCTTCATCAT, where the oligonucleotide has a phosphorothioate backbone throughout, the sugar moieties of nucleotides 1-4 and 18-21 bear 2′-O-methoxyethyl modifications, and the remaining nucleotides (nucleotides 5-17) are 2′-deoxynucleotides, and where the cytosines of nucleotides 1, 4 and 19 are 5-methylcytosines. The compound has increased stability in vivo and improved in vitro and in vivo antitumor activity.
Source: USPTO / EPO open patent data. Objective bibliographic and citation counts.